Writing Prompt June 17, 2021.
1. If a molecule of mRNA has the following nucleotide base sequences, what will be the amino acid sequence in the polypeptide synthesized by eukaryotic ribosomes? Remember, transcription begins with the start codon AUG.
a. AUGGGGAUACGCUACCCC
b. CCGUACAUGCUAAUCCCU
2. Give the mRNA and then the amino acid sequence for the following base sequence in DNA:
TACGGGGGGAGAGGGGGAGGGGGA
3. What DNA nucleotides code for the codon UGU? Identify a base pair substitution that would produce a silent mutation at this codon. Identify a base pair substitution that would result in a missense mutation at this codon. Identify a base-pair substitution that would result in a nonsense mutation at this codon.
Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.
You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.
Read moreEach paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.
Read moreThanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.
Read moreYour email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.
Read moreBy sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.
Read more